<!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v2.3 20070202//EN" "journalpublishing.dtd">
<article article-type="other" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:mml="http://www.w3.org/1998/Math/MathML">
  <front>
    <journal-meta>
      <journal-id journal-id-type="pmc">JRMS</journal-id>
      <journal-id journal-id-type="pubmed">J Res Med Sci</journal-id>
      <journal-id journal-id-type="publisher-id">Journal of Research in Medical Sciences</journal-id>
      <journal-title>Journal of Research in Medical Sciences</journal-title>
      <issn pub-type="ppub">1735-1995</issn>
	<issn pub-type="epub">1735-7136</issn>
      <publisher>
        <publisher-name>Medknow Publications Pvt Ltd</publisher-name>
	<publisher-loc>India</publisher-loc>
      </publisher>
    </journal-meta>
    <article-meta>
      <article-id pub-id-type="publisher-id">JRMS-18-20</article-id>
      <article-id pub-id-type="pmid">23961278</article-id>
      <article-categories>
	<subj-group subj-group-type="headings">
		<subject>Original Article</subject>
	</subj-group>
      </article-categories>
      <title-group>
        <article-title>Evaluation of neural gene expression in serum treated embryonic stem cells in Alzheimer&#x2032;s patients</article-title>
      </title-group>
	<contrib-group>
<contrib contrib-type="author">
<name><surname>Dehghani</surname>
<given-names>Leila</given-names></name>
<xref ref-type="aff" rid="aff1"/></contrib>
<contrib contrib-type="author">
<name><surname>Hashemi-Beni</surname>
<given-names>Batool</given-names></name>
<xref ref-type="aff" rid="aff2"/></contrib>
<contrib contrib-type="author">
<name><surname>Poorazizi</surname>
<given-names>Elahe</given-names></name>
<xref ref-type="aff" rid="aff3"/></contrib>
<contrib contrib-type="author">
<name><surname>Khorvash</surname>
<given-names>Fariborz</given-names></name>
<xref ref-type="aff" rid="aff4"/></contrib>
<contrib contrib-type="author">
<name><surname>Shaygannejad</surname>
<given-names>Vahid</given-names></name>
<xref ref-type="aff" rid="aff5"/></contrib>
<contrib contrib-type="author">
<name><surname>Sedghi</surname>
<given-names>Maryam</given-names></name>
<xref ref-type="aff" rid="aff6"/></contrib>
<contrib contrib-type="author">
<name><surname>Vesal</surname>
<given-names>Sahar</given-names></name>
<xref ref-type="aff" rid="aff7"/></contrib>
<contrib contrib-type="author">
<name><surname>Meamar</surname>
<given-names>Rokhsareh</given-names></name>
<xref ref-type="aff" rid="aff8"/><xref ref-type="corresp" rid="cor1"/></contrib>
</contrib-group>
<aff id="aff1">Department of Medical Sciences, Islamic Azad University, Najafabad Branch, Isfahan, Iran</aff><aff id="aff2">Department of Anatomical Sciences, Isfahan University of Medical Sciences, Isfahan, Iran</aff><aff id="aff3">Department of Medical Sciences, Islamic Azad University, Najafabad Branch, Isfahan, Iran</aff><aff id="aff4">Isfahan Neurosciences Research Centre, Isfahan University of Medical Sciences, Isfahan, Iran</aff><aff id="aff5">Isfahan Neurosciences Research Centre, Isfahan University of Medical Sciences, Isfahan, Iran</aff><aff id="aff6">Genetics Laboratory, Alzahra University Hospital, Isfahan University of Medical Sciences, Isfahan, Iran</aff><aff id="aff7">Isfahan Neurosciences Research Centre, Isfahan University of Medical Sciences, Isfahan, Iran</aff><aff id="aff8">Department of Medical Sciences, Islamic Azad University, Najafabad Branch; Isfahan Neurosciences Research Centre, Isfahan University of Medical Sciences, Isfahan, Iran</aff>

      <author-notes>
	<corresp id="cor1"><bold>Address for correspondence:</bold>Rokhsareh Meamar, Isfahan Neurosciences Research Centre, Isfahan University of Medical Sciences, Isfahan, Iran <email xlink:href="Meamar@Pharm.mui.ac.ir">Meamar@Pharm.mui.ac.ir</email></corresp>

      </author-notes>
      <pub-date pub-type="ppub">
        <season>March</season>
        <year>2013</year>
      </pub-date>
      <volume>18</volume>
      <issue>13</issue>
      <fpage>20</fpage>
      <lpage>23</lpage>   
      
<history>
<date date-type="received"><day>22</day><month>1</month><year>2013</year></date>

<date date-type="rev-recd"><day>9</day><month>2</month><year>2013</year></date>
</history>

      <permissions>
        <copyright-statement>Copyright: &#x000a9; Journal of Research in Medical Sciences</copyright-statement>
        <copyright-year>2013</copyright-year>
        <license license-type="open-access" xlink:href="http://creativecommons.org/licenses/by-nc-sa/3.0"><p>This is an open-access article distributed under the terms of the Creative Commons Attribution-Noncommercial-Share Alike 3.0 Unported, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</p>
</license>
      </permissions>
      <abstract><sec id="st1"><title>Background:</title><p> Previous studies confirmed that neural gene expression in embryonic stem cells (ESC) could influence by chemical compounds through stimulating apoptotic pathway. We aimed to use ESCs-derived neural cells by embryoid body formation as an in vitro model for determination of neural gene expression changes in groups that treated by sera from Alzheimer&#x2032;s patients and compare with healthy individuals. <sec id="st1"><title>Materials and Methods:</title><p> ESC line which was derived from the C57BL/6 mouse strain was used throughout this study. ESC-derived neural cells were treated with serum from Alzheimer&#x2032;s patient and healthy individual. Neural gene expression was assessed in both groups by quantitative real-time polymerase chain reaction analysis. The data was analyzed by SPSS Software (version 18). <sec id="st1"><title>Results:</title><p> Morphologically, the reducing in neurite out-growth was observed in neural cells in group, which treated by serum from Alzheimer&#x2032;s patient, while neurite growth was natural in appearance in control group. Microtubule-associated protein 2 and glial fibrillary acidic protein expression significantly reduced in the Alzheimer&#x2032;s patient group compared with the control group. Nestin expression did not significantly differ among the groups. <sec id="st1"><title>Conclusion:</title><p> Neural gene expression could be reduced in serum treated ESC in Alzheimer&#x2032;s patients.</p>
</sec>
<sec id="st2"><title>Materials and Methods:</title><p> ESC line which was derived from the C57BL/6 mouse strain was used throughout this study. ESC-derived neural cells were treated with serum from Alzheimer&#x2032;s patient and healthy individual. Neural gene expression was assessed in both groups by quantitative real-time polymerase chain reaction analysis. The data was analyzed by SPSS Software (version 18). <sec id="st2"><title>Results:</title><p> Morphologically, the reducing in neurite out-growth was observed in neural cells in group, which treated by serum from Alzheimer&#x2032;s patient, while neurite growth was natural in appearance in control group. Microtubule-associated protein 2 and glial fibrillary acidic protein expression significantly reduced in the Alzheimer&#x2032;s patient group compared with the control group. Nestin expression did not significantly differ among the groups. <sec id="st2"><title>Conclusion:</title><p> Neural gene expression could be reduced in serum treated ESC in Alzheimer&#x2032;s patients.</p>
</sec>
<sec id="st3"><title>Results:</title><p> Morphologically, the reducing in neurite out-growth was observed in neural cells in group, which treated by serum from Alzheimer&#x2032;s patient, while neurite growth was natural in appearance in control group. Microtubule-associated protein 2 and glial fibrillary acidic protein expression significantly reduced in the Alzheimer&#x2032;s patient group compared with the control group. Nestin expression did not significantly differ among the groups. <sec id="st3"><title>Conclusion:</title><p> Neural gene expression could be reduced in serum treated ESC in Alzheimer&#x2032;s patients.</p>
</sec>
<sec id="st4"><title>Conclusion:</title><p> Neural gene expression could be reduced in serum treated ESC in Alzheimer&#x2032;s patients.</p>
</sec>
</abstract>
      <kwd-group><kwd>Neural cell</kwd>
<kwd>neural gene expression</kwd>
<kwd>neurotoxicity</kwd>
</kwd-group>	
      
    </article-meta>
  </front>
  <body>
	<sec><title/>
</sec><sec><title>Introduction</title><p> </p>

<p>Embryonic stem cells (ESCs) which derived from the inner cell mass of the blastocyst are pluripotent cells that able to differentiate into different cell lineages in vitro such as neural cell, cardiac cell, and etc. <sup><xref ref-type="bibr" rid="ref1">1</xref></sup>,<sup><xref ref-type="bibr" rid="ref2">2</xref></sup> This differentiation ability have introduced them as a valuable model for diagnosing the mechanisms of cell survival, differentiation <sup><xref ref-type="bibr" rid="ref3">3</xref></sup> and especially, to create the neural cells for evaluating neurodegenerative disorders process, which are one of the main cause of human disabilities. <sup><xref ref-type="bibr" rid="ref4">4</xref></sup> It has been confirmed that neural gene expression in ESCs could influence by chemical compounds as drug, may be through stimulating apoptotic pathway. <sup><xref ref-type="bibr" rid="ref5">5</xref></sup>,<sup><xref ref-type="bibr" rid="ref1">1</xref></sup> In some neurodegenerative disorders like as Alzheimer&#x2032;s and Parkinson diseases, there is an overall shrinkage of brain tissue. <sup><xref ref-type="bibr" rid="ref6">6</xref></sup> As the disease progresses, more nerve cells lost, leading to changes in behavior, such as wandering and agitation. <sup><xref ref-type="bibr" rid="ref7">7</xref></sup>,<sup><xref ref-type="bibr" rid="ref8">8</xref></sup>,<sup><xref ref-type="bibr" rid="ref9">9</xref></sup>,<sup><xref ref-type="bibr" rid="ref10">10</xref></sup> One of the main causes of neurodegeneration is accumulation of b-amyloid plaques in the brains in Alzheimer&#x2032;s disease. <sup><xref ref-type="bibr" rid="ref7">7</xref></sup> It was implicated that disruption of normal cellular processes and high assembly of reactive oxygen and nitrogen species resulted apoptosis. <sup><xref ref-type="bibr" rid="ref8">8</xref></sup>,<sup><xref ref-type="bibr" rid="ref9">9</xref></sup> Here, we used ESCs-derived neural cells by embryoid body (EB) formation as an in vitro model for determination of neural gene expression changes in groups that treated by sera from Alzheimer&#x2032;s patients and compare with healthy individuals.</p>


</sec><sec sec-type='materials|methods'><title>Materials and Methods</title><p> </p>

<p>Mouse embryonic stem cells (mESCs) culture and differentiation mESCs, Royan B1 cell lines derived from the C57BL/6 strain, <sup><xref ref-type="bibr" rid="ref11">11</xref></sup> were kept in an undifferentiated state in Knock out Dulbecco&#x2032;s Modified Eagle Medium (KDMEM) (Invitrogen) supplemented with 15&#x0025; ESC-qualified fetal calf serum (ES-FCS) (Invitrogen) as previously reported. Neural differentiation of cells (800 cells per 20 &#956;l hanging drops) was induced by culturing the cells in hanging drops to form EBs for 2 days as previously reported. <sup><xref ref-type="bibr" rid="ref12">12</xref></sup> EBs was collected and went under suspension culture in the presence 1 mM retinoic acid (RA) (Sigma-Aldrich) for 4 days. <sup><xref ref-type="bibr" rid="ref12">12</xref></sup> On day six, the EBs were placed on gelatin coated 12 well plates, for further 8 days in the presence of neurobasal medium (Invitrogen), supplemented with 5&#x0025; sera from healthy individuals (as control group) and sera from Alzheimer&#x2032;s patients (as experimental group), 0.1 mM non-essential amino acids (Gibco), 2 mM L-glutamine (Gibco), 0.1 m Mbeta-mercaptoethanol, 1&#x0025; penicillin-streptomycin (Invitrogen) and B-27 supplement (Gibco). For assessment of neural gene expression (microtubule-associated protein 2 [Map2] as a mature neuron marker), Nestin (as an immature neuron marker) and (Glial fibrillary acidic protein [Gfap] as mature astrocyte marker), we studied the following sera added to mESCs-derived neural cells culture medium: (1) Sera from healthy individuals (2) sera from Alzheimer&#x2032;s patients and gene expression was evaluated by real-time Polymerase Chain Reaction (RT-PCR).</p>

<p> Quantitative real-time polymerase chain reaction analysis</p>

<p> Cells were collected by centrifugation and total RNA was extracted by RNeasy mini kit (Qiagen) and then treated with DNase I (Fermentas) to avoid any DNA contamination (cDNA) and was synthesized using Moloney Murine Leukemia Virus (MMLV) Reverse Transcriptase according to the manufacture protocol (Fermentas). cDNA synthesis was performed using MMLV Reverse Transcriptase and random hexamer primer according to the manufacturer protocol (Fermentas). Real-time PCR was carried out in a thermal cycler Rotor gene 6000 (Corbett). The PCR mixture contained 10 &#956;l Rotor-Gene SYBR Green PCR Master Mix (TaKaRa), 5 pM of each primer, and 50 ng cDNA for each reaction in final volume of 20 &#956;l. All samples were assessed according to the level of &#946;-tubulin expression, as internal control. All measurements were done in triplicates. Primer sequence were Map2; (forward: AAGTCACTGATGGAATAAGC, reverse: CTCTGCGAATTGGTTCTG), Nestin; (forward: CACACCTCAAGATGTCCC, reverse: GAAAGCCAAGAGAAGCCT) and Gfap; (CTCCAAGATGAAACCAAC, reverse: GCAAACTTAGACCGATACC).</p>

<p> Statistical analysis</p>

<p> The data were stated as mean &#177; SD (standard deviation). One way ANOVA followed by the Turkey&#x2032;s post hoc test multiple group comparison to find the means that were signi&#64257;cantly different from one another for data collected quantitative real-time-PCR. All experiments were replicated at least 3 times. A difference between groups was considered as statistically significant, if the P &lt; 0.05.</p>


</sec><sec><title>Results</title><p> </p>

<p>In order to evaluate effect of Alzheimer&#x2032;s patient serum on neural gene expression in mESC-derived neural cells, plated EBs were treated in two groups; in the first group, plated EBs cultured in medium containing 5&#x0025; serum from healthy individual as a control group or 5&#x0025; serum from Alzheimer&#x2032;s patient. After 7 days post-plantation, neural gene expression was assessed and compared in both groups. Morphologically, the reducing in neurite outgrowth was observed in neural cells in group which treated by serum from Alzheimer&#x2032;s patient <xref ref-type="fig" rid="F1">Figure 1</xref>a, while neurite growth was natural in appearance in control group <xref ref-type="fig" rid="F1">Figure 1</xref>b. The expression pattern of Map2, Nestin, and Gfap were quantified by real-time PCR. Map2 and Gfap expression significantly reduced in the Alzheimer&#x2032;s patient group compared with the control group <xref ref-type="fig" rid="F1">Figure 1</xref>c. Nestin expression did not significantly differ among the groups <xref ref-type="fig" rid="F1">Figure 1</xref>c.<fig id="F1"><label>Figure 1</label><caption><p>Status of neural cell with dendritic processes (a) in Alzheimer&#x2032;s patient group, (b) in control group, Scale bar: 20 &#956;m, (c) Neural gene expression (<italic>Nestin</italic>, microtubule-associated protein 2 and Glial fibrillary acidic protein) in treated groups with serum from Healthy individual and Alzheimer&#x2032;s patient. Superscript letter indicates significant difference (<italic>P</italic> &#8804; 0.05) from means labeled with different letters as determined by one-way ANOVA analysis of triplicate samples</p>
</caption><alt-text>Figure 1</alt-text><graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="JResMedSci_2013_18_13_20_114736_u1.tif"/></fig></p>


</sec><sec><title>Discussion</title><p> </p>

<p>In our study, we applied ESCs-derived neuron as an in vitro model for evaluation of neural gene expression that caused by sera from Alzheimer patient when compared with control. Our results presented that mature neuron and astrocyte markers (Map2 and Gfap) significantly decreased in patients group.</p>

<p>Previous studies have shown that the amyloid-&#946; precursor protein cleaved, its products are placed in amyloid plaques in neurodegenerative conditions such as Alzheimer disease <sup><xref ref-type="bibr" rid="ref7">7</xref></sup> that affected neural gene expression <sup><xref ref-type="bibr" rid="ref6">6</xref></sup>,<sup><xref ref-type="bibr" rid="ref12">12</xref></sup>,<sup><xref ref-type="bibr" rid="ref13">13</xref></sup> and resulted in activating apoptosis pathway, as well. <sup><xref ref-type="bibr" rid="ref6">6</xref></sup>,<sup><xref ref-type="bibr" rid="ref14">14</xref></sup> Wicklund&#x2032;s study has demonstrated that because of the existence of amyloid-&#946; the number of functional neurons decreased and it provoked both neurogenesis and apoptotic pathway, separately. <sup><xref ref-type="bibr" rid="ref6">6</xref></sup>,<sup><xref ref-type="bibr" rid="ref14">14</xref></sup></p>

<p> Some studies have shown when ESC exposed to amyloid-&#946;, Gfap expression was increased in neural differentiation process, <sup><xref ref-type="bibr" rid="ref6">6</xref></sup> but increment of Gfap expression was seen in present research. Compared with Wicklund&#x2032;s study, it seem this change has been made due to change in cell type or existence of other factor such as Nitric Oxide (NO). <sup><xref ref-type="bibr" rid="ref14">14</xref></sup>,<sup><xref ref-type="bibr" rid="ref15">15</xref></sup>,<sup><xref ref-type="bibr" rid="ref16">16</xref></sup> Furthermore, like as other study Map2 expression reduced following treatment of ESC by Alzheimer&#x2032;s patient serum. <sup><xref ref-type="bibr" rid="ref6">6</xref></sup></p>

<p> In previous literature, too much production of NO in serum of Alzheimer&#x2032;s disease has been associated with cytotoxicity in brain, <sup><xref ref-type="bibr" rid="ref17">17</xref></sup> which regulated apoptosis in these cells which were treated by serum from Alzheimer&#x2032;s patients. Not only was stress oxidative induced apoptosis, also neural gene expression was affected in ESC derived neural cells treated by Alzheimer&#x2032;s disease (AD) serum. <sup><xref ref-type="bibr" rid="ref7">7</xref></sup>,<sup><xref ref-type="bibr" rid="ref17">17</xref></sup> Our previous study showed that Map2 and Nestin expression decreased in neural cells treated by Methamphetamine. <sup><xref ref-type="bibr" rid="ref5">5</xref></sup></p>

<p> In the current study, we supposed that neural gene expression has been reduced due to AD serum induced apoptosis and also NO production. Dildar et al. <sup><xref ref-type="bibr" rid="ref17">17</xref></sup> indicated serum levels of NO are elevated in probable AD patients and suppress neural gene expression. <sup><xref ref-type="bibr" rid="ref7">7</xref></sup></p>

<p> Overall, the results of this study and its comparison with literature studies confirmed that firstly these cells could be used as an efficient model for neurotoxic studies like as other studies, secondly neural gene expression decreased in Alzheimer&#x2032;s patients that need to be studied more and it can be concluded that Neural and cardiac differentiation protocol of mESCs has been applied to assess the developmental neurotoxicity and cardiotoxicity. <sup><xref ref-type="bibr" rid="ref2">2</xref></sup>,<sup><xref ref-type="bibr" rid="ref5">5</xref></sup>,<sup><xref ref-type="bibr" rid="ref18">18</xref></sup>,<sup><xref ref-type="bibr" rid="ref19">19</xref></sup> Different studies have been tried to improve the mechanisms of activity or reduction of neurotoxicity, in addition to identifying new strategies that have higher therapeutic efficiency in neurodegeneration.</p>


</sec><sec><title>Acknowledgment</title><p> </p>

<p>We are grateful to Isfahan Neurosciences Research Isfahan and all the patients those who helped progression of our project.</p>
</sec>
  </body>
  <back>
	
	
	    <ref-list><ref id="ref1">
<label>1</label>
<nlm-citation citation-type="journal">
<person-group person-group-type="author"><name> 
  <surname>Meamar</surname>
  <given-names>R</given-names>
</name>
<name> 
  <surname>Karamali</surname>
  <given-names>F</given-names>
</name>
<name> 
  <surname>Sadeghi</surname>
  <given-names>HM</given-names>
</name>
<name> 
  <surname>Etebari</surname>
  <given-names>M</given-names>
</name>
<name> 
  <surname>Nasr-Esfahani</surname>
  <given-names>MH</given-names>
</name>
<name> 
  <surname>Baharvand</surname>
  <given-names>H</given-names>
</name>
</person-group><article-title>Toxicity of ecstasy (MDMA) towards embryonic stem cell-derived cardiac and neural cells</article-title><source>Toxicol in vitro</source>
<year>2010</year>
<volume>24</volume>
<fpage>1133</fpage>
<lpage>8</lpage>
</nlm-citation>
</ref>
<ref id="ref2">
<label>2</label>
<nlm-citation citation-type="journal">
<person-group person-group-type="author"><name> 
  <surname>Dehghani</surname>
  <given-names>L</given-names>
</name>
<name> 
  <surname>Farokhpour</surname>
  <given-names>M</given-names>
</name>
<name> 
  <surname>Karbalaie</surname>
  <given-names>K</given-names>
</name>
<name> 
  <surname>Nematollahi</surname>
  <given-names>M</given-names>
</name>
<name> 
  <surname>Tanhaie</surname>
  <given-names>S</given-names>
</name>
<name> 
  <surname>Hayati-Rodbari</surname>
  <given-names>N</given-names>
</name>
 <etal/>
</person-group><article-title>The infl uence of dexamethasone administration on the protection against doxorubicin-induced cardiotoxicity in purified embryonic stem cell-derived cardiomyocytes.Tissue Cell 2012</article-title><source>pii: S-()-</source>
<year>0</year>
<volume></volume>
<fpage></fpage>
<comment> The infl uence of dexamethasone administration on the protection against doxorubicin-induced cardiotoxicity in purified embryonic stem cell-derived cardiomyocytes Tissue Cell 2012pii: S0040-8166(12)00090-0 doi: 101016/jtice201209009 [Epub ahead of print]</comment>
</nlm-citation>
</ref>
<ref id="ref3">
<label>3</label>
<nlm-citation citation-type="journal">
<person-group person-group-type="author"><name> 
  <surname>Zhong</surname>
  <given-names>J</given-names>
</name>
<name> 
  <surname>Deng</surname>
  <given-names>J</given-names>
</name>
<name> 
  <surname>Huang</surname>
  <given-names>S</given-names>
</name>
<name> 
  <surname>Yang</surname>
  <given-names>X</given-names>
</name>
<name> 
  <surname>Lee</surname>
  <given-names>WH</given-names>
</name>
</person-group><article-title>High K&#x002B;and IGF-1 protect cerebellar granule neurons via distinct signaling pathways</article-title><source>J Neurosci Res</source>
<year>2004</year>
<volume>75</volume>
<fpage>794</fpage>
<lpage>806</lpage>
</nlm-citation>
</ref>
<ref id="ref4">
<label>4</label>
<nlm-citation citation-type="journal">
<person-group person-group-type="author"><name> 
  <surname>Lindvall</surname>
  <given-names>O</given-names>
</name>
<name> 
  <surname>Kokaia</surname>
  <given-names>Z</given-names>
</name>
</person-group><article-title>Stem cells in human neurodegenerative disorders - Time for clinical translation&#x003F;</article-title><source>J Clin Invest</source>
<year>2010</year>
<volume>120</volume>
<fpage>29</fpage>
<lpage>40</lpage>
</nlm-citation>
</ref>
<ref id="ref5">
<label>5</label>
<nlm-citation citation-type="journal">
<person-group person-group-type="author"><name> 
  <surname>Meamar</surname>
  <given-names>R</given-names>
</name>
<name> 
  <surname>Dehghani</surname>
  <given-names>L</given-names>
</name>
<name> 
  <surname>Karamali</surname>
  <given-names>F</given-names>
</name>
</person-group><article-title>Toxicity effects of methamphetamine on embry-onic stem cell-derived neuron</article-title><source>J Res Med Sci</source>
<year>2012</year>
<volume>17</volume>
<fpage>470</fpage>
<lpage>4</lpage>
</nlm-citation>
</ref>
<ref id="ref6">
<label>6</label>
<nlm-citation citation-type="journal">
<person-group person-group-type="author"><name> 
  <surname>Wicklund</surname>
  <given-names>L</given-names>
</name>
<name> 
  <surname>Le&#227;o</surname>
  <given-names>RN</given-names>
</name>
<name> 
  <surname>Str&#246;mberg</surname>
  <given-names>AM</given-names>
</name>
<name> 
  <surname>Mousavi</surname>
  <given-names>M</given-names>
</name>
<name> 
  <surname>Hovak a</surname>
  <given-names>O</given-names>
</name>
<name> 
  <surname>Nordberg</surname>
  <given-names>A</given-names>
</name>
 <etal/>
</person-group><article-title>&#194;-amyloid 1-42 oligomers impair function of human embryonic stem cell-derived forebrain cholinergic neurons.PLoS One 2010;5:e15600</article-title><source>doi:</source>
<year>0</year>
<volume></volume>
<fpage></fpage>
<comment> &#194;-amyloid 1-42 oligomers impair function of human embryonic stem cell-derived forebrain cholinergic neurons PLoS One 2010;5:e15600 doi: 101371/journalpone0015600</comment>
</nlm-citation>
</ref>
<ref id="ref7">
<label>7</label>
<nlm-citation citation-type="journal">
<person-group person-group-type="author"><name> 
  <surname>Porayette</surname>
  <given-names>P</given-names>
</name>
<name> 
  <surname>Gallego</surname>
  <given-names>MJ</given-names>
</name>
<name> 
  <surname>Kaltcheva</surname>
  <given-names>MM</given-names>
</name>
<name> 
  <surname>Bowen</surname>
  <given-names>RL</given-names>
</name>
<name> 
  <surname>Vadakkadath Meethal</surname>
  <given-names>S</given-names>
</name>
<name> 
  <surname>Atwood</surname>
  <given-names>CS</given-names>
</name>
</person-group><article-title>Differential processing of amyloid-beta precursor protein directs human embryonic stem cell proliferation and differentiation into neuronal precursor cells</article-title><source>J Biol Chem</source>
<year>2009</year>
<volume>284</volume>
<fpage>23806</fpage>
<lpage>17</lpage>
</nlm-citation>
</ref>
<ref id="ref8">
<label>8</label>
<nlm-citation citation-type="journal">
<person-group person-group-type="author"><name> 
  <surname>Hardy</surname>
  <given-names>J</given-names>
</name>
<name> 
  <surname>Selkoe</surname>
  <given-names>DJ</given-names>
</name>
</person-group><article-title>The amyloid hypothesis of Alzheimer&#x2032;s disease: Progress and problems on the road to therapeutics</article-title><source>Science</source>
<year>2002</year>
<volume>297</volume>
<fpage>353</fpage>
<lpage>6</lpage>
</nlm-citation>
</ref>
<ref id="ref9">
<label>9</label>
<nlm-citation citation-type="journal">
<person-group person-group-type="author"><name> 
  <surname>Nat</surname>
  <given-names>R</given-names>
</name>
<name> 
  <surname>Nilbratt</surname>
  <given-names>M</given-names>
</name>
<name> 
  <surname>Narkilahti</surname>
  <given-names>S</given-names>
</name>
<name> 
  <surname>Winblad</surname>
  <given-names>B</given-names>
</name>
<name> 
  <surname>Hovatta</surname>
  <given-names>O</given-names>
</name>
<name> 
  <surname>Nordberg</surname>
  <given-names>A</given-names>
</name>
</person-group><article-title>Neurogenic neuroepithelial and radial glial cells generated from six human embryonic stem cell lines in serum-free suspension and adherent cultures</article-title><source>Glia</source>
<year>2007</year>
<volume>55</volume>
<fpage>385</fpage>
<lpage>99</lpage>
</nlm-citation>
</ref>
<ref id="ref10">
<label>10</label>
<nlm-citation citation-type="journal">
<person-group person-group-type="author"><name> 
  <surname>Haughey</surname>
  <given-names>NJ</given-names>
</name>
<name> 
  <surname>Nath</surname>
  <given-names>A</given-names>
</name>
<name> 
  <surname>Chan</surname>
  <given-names>SL</given-names>
</name>
<name> 
  <surname>Borchard</surname>
  <given-names>AC</given-names>
</name>
<name> 
  <surname>Rao</surname>
  <given-names>MS</given-names>
</name>
<name> 
  <surname>Mattson</surname>
  <given-names>MP</given-names>
</name>
</person-group><article-title>Disruption of neurogenesis by amyloid beta-peptide, and perturbed neural progenitor cell homeostasis, in models of Alzheimer&#x2032;s disease</article-title><source>J Neurochem</source>
<year>2002</year>
<volume>83</volume>
<fpage>1509</fpage>
<lpage>24</lpage>
</nlm-citation>
</ref>
<ref id="ref11">
<label>11</label>
<nlm-citation citation-type="journal">
<person-group person-group-type="author"><name> 
  <surname>Baharvand</surname>
  <given-names>H</given-names>
</name>
<name> 
  <surname>Matthaei</surname>
  <given-names>KI</given-names>
</name>
</person-group><article-title>Culture condition difference for establishment of new embryonic stem cell lines from the C57BL/6 and BALB/c mouse strains</article-title><source>In vitro Cell Dev Biol Anim</source>
<year>2004</year>
<volume>40</volume>
<fpage>76</fpage>
<lpage>81</lpage>
</nlm-citation>
</ref>
<ref id="ref12">
<label>12</label>
<nlm-citation citation-type="journal">
<person-group person-group-type="author"><name> 
  <surname>Ostadsharif</surname>
  <given-names>M</given-names>
</name>
<name> 
  <surname>Ghaedi</surname>
  <given-names>K</given-names>
</name>
<name> 
  <surname>Hossein Nasr-Esfahani</surname>
  <given-names>M</given-names>
</name>
<name> 
  <surname>Mojbafan</surname>
  <given-names>M</given-names>
</name>
<name> 
  <surname>Tanhaie</surname>
  <given-names>S</given-names>
</name>
<name> 
  <surname>Karbalaie</surname>
  <given-names>K</given-names>
</name>
 <etal/>
</person-group><article-title>The expression of peroxisomal protein transcripts increased by retinoic acid during neural differentiation</article-title><source>Differentiation</source>
<year>2011</year>
<volume>81</volume>
<fpage>127</fpage>
<lpage>32</lpage>
</nlm-citation>
</ref>
<ref id="ref13">
<label>13</label>
<nlm-citation citation-type="journal">
<person-group person-group-type="author"><name> 
  <surname>Lee</surname>
  <given-names>HK</given-names>
</name>
<name> 
  <surname>Kumar</surname>
  <given-names>P</given-names>
</name>
<name> 
  <surname>Fu</surname>
  <given-names>Q</given-names>
</name>
<name> 
  <surname>Rosen</surname>
  <given-names>KM</given-names>
</name>
<name> 
  <surname>Querfurth</surname>
  <given-names>HW</given-names>
</name>
</person-group><article-title>The insulin/Akt signaling pathway is targeted by intracellular beta-amyloid</article-title><source>Mol Biol Cell</source>
<year>2009</year>
<volume>20</volume>
<fpage>1533</fpage>
<lpage>44</lpage>
</nlm-citation>
</ref>
<ref id="ref14">
<label>14</label>
<nlm-citation citation-type="journal">
<person-group person-group-type="author"><name> 
  <surname>Corzo</surname>
  <given-names>L</given-names>
</name>
<name> 
  <surname>Zas</surname>
  <given-names>R</given-names>
</name>
<name> 
  <surname>Rodr&#237;guez</surname>
  <given-names>S</given-names>
</name>
<name> 
  <surname>Fern&#225;ndez-Novoa</surname>
  <given-names>L</given-names>
</name>
<name> 
  <surname>Cacabelos</surname>
  <given-names>R</given-names>
</name>
</person-group><article-title>Decreased levels of serum nitric oxide in different forms of dementia</article-title><source>Neurosci Lett</source>
<year>2007</year>
<volume>420</volume>
<fpage>263</fpage>
<lpage>7</lpage>
</nlm-citation>
</ref>
<ref id="ref15">
<label>15</label>
<nlm-citation citation-type="journal">
<person-group person-group-type="author"><name> 
  <surname>C&#225;rdenas</surname>
  <given-names>A</given-names>
</name>
<name> 
  <surname>Moro</surname>
  <given-names>MA</given-names>
</name>
<name> 
  <surname>Hurtado</surname>
  <given-names>O</given-names>
</name>
<name> 
  <surname>Leza</surname>
  <given-names>JC</given-names>
</name>
<name> 
  <surname>Lizasoain</surname>
  <given-names>I</given-names>
</name>
</person-group><article-title>Dual role of nitric oxide in adult neurogenesis</article-title><source>Brain Res Brain Res Rev</source>
<year>2005</year>
<volume>50</volume>
<fpage>1</fpage>
<lpage>6</lpage>
</nlm-citation>
</ref>
<ref id="ref16">
<label>16</label>
<nlm-citation citation-type="journal">
<person-group person-group-type="author"><name> 
  <surname>Davies</surname>
  <given-names>MG</given-names>
</name>
<name> 
  <surname>Fulton</surname>
  <given-names>GJ</given-names>
</name>
<name> 
  <surname>Hagen</surname>
  <given-names>PO</given-names>
</name>
</person-group><article-title>Clinical biology of nitric oxide</article-title><source>Br J Surg</source>
<year>1995</year>
<volume>82</volume>
<fpage>1598</fpage>
<lpage>610</lpage>
</nlm-citation>
</ref>
<ref id="ref17">
<label>17</label>
<nlm-citation citation-type="journal">
<person-group person-group-type="author"><name> 
  <surname>Dildar</surname>
  <given-names>K</given-names>
</name>
<name> 
  <surname>Sinem</surname>
  <given-names>F</given-names>
</name>
<name> 
  <surname>G&#246;khan</surname>
  <given-names>E</given-names>
</name>
<name> 
  <surname>Orhan</surname>
  <given-names>Y</given-names>
</name>
<name> 
  <surname>Filiz</surname>
  <given-names>M</given-names>
</name>
</person-group><article-title>Serum nitrosative stress levels are increased in Alzheimer disease but not in vascular dementia</article-title><source>Alzheimer Dis Assoc Disord</source>
<year>2010</year>
<volume>24</volume>
<fpage>194</fpage>
<lpage>7</lpage>
</nlm-citation>
</ref>
<ref id="ref18">
<label>18</label>
<nlm-citation citation-type="journal">
<person-group person-group-type="author"><name> 
  <surname>Farokhpour</surname>
  <given-names>M</given-names>
</name>
<name> 
  <surname>Karbalaie</surname>
  <given-names>K</given-names>
</name>
<name> 
  <surname>Tanhaei</surname>
  <given-names>S</given-names>
</name>
<name> 
  <surname>Nematollahi</surname>
  <given-names>M</given-names>
</name>
<name> 
  <surname>Etebari</surname>
  <given-names>M</given-names>
</name>
<name> 
  <surname>Sadeghi</surname>
  <given-names>HM</given-names>
</name>
 <etal/>
</person-group><article-title>Embryonic stem cell-derived cardiomyocytes as a model system to study cardioprotective effects of dexamethasone in doxorubicin cardiotoxicity</article-title><source>Toxicol in vitro</source>
<year>2009</year>
<volume>23</volume>
<fpage>1422</fpage>
<lpage>8</lpage>
</nlm-citation>
</ref>
<ref id="ref19">
<label>19</label>
<nlm-citation citation-type="journal">
<person-group person-group-type="author"><name> 
  <surname>L&#243;pez-Toledano</surname>
  <given-names>MA</given-names>
</name>
<name> 
  <surname>Shelanski</surname>
  <given-names>ML</given-names>
</name>
</person-group><article-title>Neurogenic effect of beta-amyloid peptide in the development of neural stem cells</article-title><source>J Neurosci</source>
<year>2004</year>
<volume>24</volume>
<fpage>5439</fpage>
<lpage>44</lpage>
</nlm-citation>
</ref>
<ref id="ref20">
<label>20</label>
<nlm-citation citation-type="journal">
<person-group person-group-type="author"></person-group><article-title></article-title><source></source>
<year></year>
<volume></volume>
<fpage></fpage>
</nlm-citation>
</ref>
</ref-list>

  </back>
	
</article> 




